Re: File position and buffers

Path	csiph.com!x330-a1.tempe.blueboxinc.net!usenet.pasdenom.info!news.dougwise.org!nntpfeed.proxad.net!proxad.net!feeder1-2.proxad.net!usenet-fr.net!de-l.enfer-du-nord.net!feeder2.enfer-du-nord.net!feeds.phibee-telecom.net!talisker.lacave.net!lacave.net!not-for-mail
From	Cee Joe <cyril_jose@ymail.com>
Newsgroups	comp.lang.ruby
Subject	Re: File position and buffers
Date	Fri, 29 Apr 2011 13:32:00 -0500
Organization	Service de news de lacave.net
Lines	41
Message-ID	<ae08ac328a97a170cbe366bc7fd10a2c@ruby-forum.com> (permalink)
References	<10d8ae57765e21626a7c64873dcba807@ruby-forum.com> <12ea664fa8ebe548db95a756061e6489@ruby-forum.com>
NNTP-Posting-Host	bristol.highgroove.com
Content-Type	text/plain; charset=UTF-8
Content-Transfer-Encoding	7bit
X-Trace	talisker.lacave.net 1304101965 16790 65.111.164.187 (29 Apr 2011 18:32:45 GMT)
X-Complaints-To	abuse@lacave.net
NNTP-Posting-Date	Fri, 29 Apr 2011 18:32:45 +0000 (UTC)
In-Reply-To	<12ea664fa8ebe548db95a756061e6489@ruby-forum.com>
X-Received-From	This message has been automatically forwarded from the ruby-talk mailing list by a gateway at comp.lang.ruby. If it is SPAM, it did not originate at comp.lang.ruby. Please report the original sender, and not us. Thanks! For more details about this gateway, please visit: http://blog.grayproductions.net/categories/the_gateway
X-Mail-Count	382392
X-Ml-Name	ruby-talk
X-Rubymirror	Yes
X-Ruby-Talk	<ae08ac328a97a170cbe366bc7fd10a2c@ruby-forum.com>
Xref	x330-a1.tempe.blueboxinc.net comp.lang.ruby:3707

Show key headers only | View raw

7stud -- wrote in post #995821:
> I suggest that people never use irb because it has too many quirks.
>
> The first thing you need to realize is that '>' is
> not the separator you want to look for.  That is the second bit of
> erroneous advice your mentor gave you.  That's because you don't care
> what character marks the beginning of every entry, rather you care what
> character marks the end of every entry.  The end of every entry in your
> file is marked by the string "\n\n", so you should use that as your
> input line terminator.  Remember, ruby uses "\n" for the input line
> separator by default, which means that when you read a file using
> IO#each, ruby reads lines--where the end of a line is marked by a
> newline.

I understand the logic, it makes sense. What if the file looked like 
this, where there is one newline seperating the entries? :

>gi|329295464|ref|NM_2005745.3Acc1| Def1 zgc:65895 (zgc:65895), mRNA
AGCTCGGGGGCTCTAGCGATTTAAGGAGCGATGCGATCGAGCTGACCGTCGCG
>gi|456299107|ref|NM_2342343.3Acc2| Def2 zgc:65895 (zgc:65895), mRNA
GTCGCTGGGTCGAAAAGTGGTGCTATATCGCGGCTCGCGTCGATGTCGCGATG
CGTGCGCGCGAGAGCGCGCTATGATGAAAGGATGAGAGAG
>gi|3542945647|ref|NM_7453343.5Acc3| Def3 zgc:65895 (zgc:65895), mRNA
CGTGCGGGGABCCGTACGTGCCGTGGGGGTTTAATAGCGCGCCATCTGAGCAG
TTAGTCGCTGACGCATGCACG

Would an if-else(regarding"\n" and "\n\n") do the trick? I wanted to 
write my code to where it would handle both scenarios. Or maybe:

case
  when "\n\n"
    <code>
  when "\n"
    <code>
end

something to that extent? Suggestions?

-- 
Posted via http://www.ruby-forum.com/.

Thread

File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-27 15:02 -0500
  Re: File position and buffers Jesús Gabriel y Galán <jgabrielygalan@gmail.com> - 2011-04-27 16:47 -0500
  Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-27 17:33 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-27 19:08 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-27 19:50 -0500
  Re: File position and buffers Robert Klemme <shortcutter@googlemail.com> - 2011-04-28 02:54 -0500
    Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 13:06 -0500
      Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 13:25 -0500
        Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 13:29 -0500
  Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 09:06 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 12:47 -0500
    Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 13:27 -0500
      Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 18:31 -0500
        Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 20:05 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 21:58 -0500
    Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 10:20 -0500
  Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-28 22:36 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-29 12:50 -0500
    Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 13:32 -0500
      Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-29 17:45 -0500
  Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-29 15:38 -0500
  Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 16:10 -0500

csiph-web