Groups | Search | Server Info | Keyboard shortcuts | Login | Register [http] [https] [nntp] [nntps]
Groups > comp.lang.ruby > #3667
| From | Cee Joe <cyril_jose@ymail.com> |
|---|---|
| Newsgroups | comp.lang.ruby |
| Subject | Re: File position and buffers |
| Date | 2011-04-28 20:05 -0500 |
| Organization | Service de news de lacave.net |
| Message-ID | <859f1a6ec8eae502d91f42f274c1d8aa@ruby-forum.com> (permalink) |
| References | <10d8ae57765e21626a7c64873dcba807@ruby-forum.com> <97869b15e6f881b951b4b230011182e0@ruby-forum.com> <a8bfb33ef4ce932d8afc29b01bb29252@ruby-forum.com> <c73bca63732c4f7e0943455cdc55a935@ruby-forum.com> |
> 2) Read one entry, do something to the entry, then discard it and read
> in the next entry.
This is what I want to do. Read one entry, extract information from it,
then read next entry. He says using an array will take up a lot of
memory so he said use a buffer.
> But, you will end up reading every entry twice, which
> is stupid. The easiest way to read in the file and prepare each entry
> is to set the input separator to "\n\n", then use each() to read in a
> paragraph, then use split("\n") to split each entry into lines, then add
> back a \n to the first line.
>
> Also, are you aware that this:
>
>>gi|456299107|ref|NM_2342343.3Acc2| Def2 zgc:65895 (zgc:65895), mRNA\n
> GTCGCTGGGTCGAAAAGTGGTGCTATATCGCGGCTCGCGTCGATGTCGCGATG <-- no "\n"
> CGTGCGCGCGAGAGCGCGCTATGATGAAAGGATGAGAGAG <-- no "\n"
>
> is equivalent to:
>
>>gi|456299107|ref|NM_2342343.3Acc2| Def2 zgc:65895 (zgc:65895), mRNA
>
GTCGCTGGGTCGAAAAGTGGTGCTATATCGCGGCTCGCGTCGATGTCGCGATGCGTGCGCGCGAGAGCGCGCTATGATGAAAGGATGAGAGAG
Yes I am aware of that - I just put "no \n" for emphasis. Regarding the
pos(), I think he said to use it as a guide to help with the detection
of each ">" . Thanks for being patient and helping out.
--
Posted via http://www.ruby-forum.com/.
Back to comp.lang.ruby | Previous | Next — Previous in thread | Next in thread | Find similar | Unroll thread
File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-27 15:02 -0500
Re: File position and buffers Jesús Gabriel y Galán <jgabrielygalan@gmail.com> - 2011-04-27 16:47 -0500
Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-27 17:33 -0500
Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-27 19:08 -0500
Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-27 19:50 -0500
Re: File position and buffers Robert Klemme <shortcutter@googlemail.com> - 2011-04-28 02:54 -0500
Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 13:06 -0500
Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 13:25 -0500
Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 13:29 -0500
Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 09:06 -0500
Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 12:47 -0500
Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 13:27 -0500
Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 18:31 -0500
Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 20:05 -0500
Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 21:58 -0500
Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 10:20 -0500
Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-28 22:36 -0500
Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-29 12:50 -0500
Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 13:32 -0500
Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-29 17:45 -0500
Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-29 15:38 -0500
Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 16:10 -0500
csiph-web