Groups | Search | Server Info | Keyboard shortcuts | Login | Register [http] [https] [nntp] [nntps]


Groups > comp.lang.ruby > #3703

Re: File position and buffers

From 7stud -- <bbxx789_05ss@yahoo.com>
Newsgroups comp.lang.ruby
Subject Re: File position and buffers
Date 2011-04-29 12:50 -0500
Organization Service de news de lacave.net
Message-ID <12ea664fa8ebe548db95a756061e6489@ruby-forum.com> (permalink)
References <10d8ae57765e21626a7c64873dcba807@ruby-forum.com>

Show all headers | View raw


The first thing everyone in this thread needs to realize is that '>' is 
not the separator you want to look for.  That's because you don't care 
what character marks the beginning of every entry, rather you care what 
character marks the end of every entry.  The end of every entry is 
marked by the string "\n\n", so you should use that has your input line 
terminator.  Remember, ruby uses "\n" for the input line separator by 
default, which means that when you read a file using IO#each, ruby reads 
lines--where the end of a line is marked by a newline.  However, you can 
change the input line separator to the string "\n\n" (or any other 
string):

$/ = "\n\n"


Once you have an entry, then you just need to do a little housekeeping 
and remove some "\n" characters.



require 'stringio'

str =<<ENDOFSTRING
>gi|329295464|ref|NM_2005745.3Acc1| Def1 zgc:65895 (zgc:65895), mRNA
AGCTCGGGGGCTCTAGCGATTTAAGGAGCGATGCGATCGAGCTGACCGTCGCG

>gi|456299107|ref|NM_2342343.3Acc2| Def2 zgc:65895 (zgc:65895), mRNA
GTCGCTGGGTCGAAAAGTGGTGCTATATCGCGGCTCGCGTCGATGTCGCGATG
CGTGCGCGCGAGAGCGCGCTATGATGAAAGGATGAGAGAG

>gi|3542945647|ref|NM_7453343.5Acc3| Def3 zgc:65895 (zgc:65895), mRNA
CGTGCGGGGABCCGTACGTGCCGTGGGGGTTTAATAGCGCGCCATCTGAGCAG
TTAGTCGCTGACGCATGCACG

ENDOFSTRING


input = StringIO.new(str)  #Now input is just like a File

input.each(sep = "\n\n") do |para|
  buffer = ''

  lines = para.split("\n")
  buffer << lines.shift << "\n"
  lines.each do |line|
    buffer << line
  end

  puts buffer
  puts "-" * 20
end

p $/

--output:--
>gi|329295464|ref|NM_2005745.3Acc1| Def1 zgc:65895 (zgc:65895), mRNA
AGCTCGGGGGCTCTAGCGATTTAAGGAGCGATGCGATCGAGCTGACCGTCGCG
--------------------
>gi|456299107|ref|NM_2342343.3Acc2| Def2 zgc:65895 (zgc:65895), mRNA
GTCGCTGGGTCGAAAAGTGGTGCTATATCGCGGCTCGCGTCGATGTCGCGATGCGTGCGCGCGAGAGCGCGCTATGATGAAAGGATGAGAGAG
--------------------
>gi|3542945647|ref|NM_7453343.5Acc3| Def3 zgc:65895 (zgc:65895), mRNA
CGTGCGGGGABCCGTACGTGCCGTGGGGGTTTAATAGCGCGCCATCTGAGCAGTTAGTCGCTGACGCATGCACG
--------------------
"\n"


Note that specifying the new input line separator as an argument to 
each() serves to restore the original input line separator once the 
block has finished--which is a good thing.

-- 
Posted via http://www.ruby-forum.com/.

Back to comp.lang.ruby | Previous | NextPrevious in thread | Next in thread | Find similar | Unroll thread


Thread

File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-27 15:02 -0500
  Re: File position and buffers Jesús Gabriel y Galán <jgabrielygalan@gmail.com> - 2011-04-27 16:47 -0500
  Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-27 17:33 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-27 19:08 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-27 19:50 -0500
  Re: File position and buffers Robert Klemme <shortcutter@googlemail.com> - 2011-04-28 02:54 -0500
    Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 13:06 -0500
      Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 13:25 -0500
        Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 13:29 -0500
  Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 09:06 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 12:47 -0500
    Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 13:27 -0500
      Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 18:31 -0500
        Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 20:05 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 21:58 -0500
    Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 10:20 -0500
  Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-28 22:36 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-29 12:50 -0500
    Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 13:32 -0500
      Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-29 17:45 -0500
  Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-29 15:38 -0500
  Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 16:10 -0500

csiph-web