Re: File position and buffers

From	Cee Joe <cyril_jose@ymail.com>
Newsgroups	comp.lang.ruby
Subject	Re: File position and buffers
Date	2011-04-29 16:10 -0500
Organization	Service de news de lacave.net
Message-ID	<090da92f89a453132178ba5faadfcc2c@ruby-forum.com> (permalink)
References	<10d8ae57765e21626a7c64873dcba807@ruby-forum.com>

Show all headers | View raw

Hi Jake,

I would still need the header intact, which should be away from the rest 
of the entry:

>gi|329295464|ref|NM_2005745.3Acc1| Def1 zgc:65895 (zgc:65895), mRNA
AGCTCGGGGGCTCTAGCGATTTAAGGAGCGATGCGATCGAGCTGACCGTCGCG

instead of:

">gi|329295464|ref|NM_2005745.3Acc1| Def1 zgc:65895 (zgc:65895),
mRNAAGCTCGGGGGCTCTAGCGATTTAAGGAGCGATGCGATCGAGCTGACCGTCGCG>"

Still need the header line so I can extract information from that and 
the lines after that in each entry. Your delete() will delete all the 
newlines, which would not be beneficial in this scenario. Thanks for the 
input, appreciate it.

-Cee

-- 
Posted via http://www.ruby-forum.com/.

Back to comp.lang.ruby | Previous | Next — Previous in thread | Find similar | Unroll thread

Thread

File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-27 15:02 -0500
  Re: File position and buffers Jesús Gabriel y Galán <jgabrielygalan@gmail.com> - 2011-04-27 16:47 -0500
  Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-27 17:33 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-27 19:08 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-27 19:50 -0500
  Re: File position and buffers Robert Klemme <shortcutter@googlemail.com> - 2011-04-28 02:54 -0500
    Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 13:06 -0500
      Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 13:25 -0500
        Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 13:29 -0500
  Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 09:06 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 12:47 -0500
    Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 13:27 -0500
      Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 18:31 -0500
        Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 20:05 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 21:58 -0500
    Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 10:20 -0500
  Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-28 22:36 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-29 12:50 -0500
    Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 13:32 -0500
      Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-29 17:45 -0500
  Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-29 15:38 -0500
  Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 16:10 -0500

csiph-web