Groups | Search | Server Info | Keyboard shortcuts | Login | Register [http] [https] [nntp] [nntps]

Groups > comp.lang.ruby > #3726

Re: File position and buffers

Show all headers | View raw

Cee Joe wrote in post #995830:
> 7stud -- wrote in post #995821:
>> I suggest that people never use irb because it has too many quirks.
>>
>> The first thing you need to realize is that '>' is
>> not the separator you want to look for.  That is the second bit of
>> erroneous advice your mentor gave you.  That's because you don't care
>> what character marks the beginning of every entry, rather you care what
>> character marks the end of every entry.  The end of every entry in your
>> file is marked by the string "\n\n", so you should use that as your
>> input line terminator.  Remember, ruby uses "\n" for the input line
>> separator by default, which means that when you read a file using
>> IO#each, ruby reads lines--where the end of a line is marked by a
>> newline.
>
> I understand the logic, it makes sense. What if the file looked like
> this, where there is one newline seperating the entries? :

What if you had presented that possibility from the very beginning?


require 'stringio'

str =<<ENDOFSTRING
>gi|329295464|ref|NM_2005745.3Acc1| Def1 zgc:65895 (zgc:65895), mRNA
AGCTCGGGGGCTCTAGCGATTTAAGGAGCGATGCGATCGAGCTGACCGTCGCG

>gi|456299107|ref|NM_2342343.3Acc2| Def2 zgc:65895 (zgc:65895), mRNA
GTCGCTGGGTCGAAAAGTGGTGCTATATCGCGGCTCGCGTCGATGTCGCGATG
CGTGCGCGCGAGAGCGCGCTATGATGAAAGGATGAGAGAG

>gi|3542945647|ref|NM_7453343.5Acc3| Def3 zgc:65895 (zgc:65895), mRNA
CGTGCGGGGABCCGTACGTGCCGTGGGGGTTT
AATAGCGCGCCATCTGAGCAG
TTAGTCGCTGACGCATGCACG

ENDOFSTRING

input = StringIO.new(str)
buffer = ''

input.each do |line|
  if line[0, 1] == '>'
    if buffer != ''
      puts buffer  #or do something else to buffer
      puts '-' * 20
    end

    buffer = ''
    buffer << line
  else
    buffer << line.sub(/ \n+ \z /xms, '')
  end

end

puts buffer   #or do something else to buffer

--output:--
>gi|329295464|ref|NM_2005745.3Acc1| Def1 zgc:65895 (zgc:65895), mRNA
AGCTCGGGGGCTCTAGCGATTTAAGGAGCGATGCGATCGAGCTGACCGTCGCG
--------------------
>gi|456299107|ref|NM_2342343.3Acc2| Def2 zgc:65895 (zgc:65895), mRNA
GTCGCTGGGTCGAAAAGTGGTGCTATATCGCGGCTCGCGTCGATGTCGCGATGCGTGCGCGCGAGAGCGCGCTATGATGAAAGGATGAGAGAG
--------------------
>gi|3542945647|ref|NM_7453343.5Acc3| Def3 zgc:65895 (zgc:65895), mRNA
CGTGCGGGGABCCGTACGTGCCGTGGGGGTTTAATAGCGCGCCATCTGAGCAGTTAGTCGCTGACGCATGCACG

-- 
Posted via http://www.ruby-forum.com/.

Back to comp.lang.ruby | Previous | Next — Previous in thread | Next in thread | Find similar | Unroll thread

Thread

File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-27 15:02 -0500
  Re: File position and buffers Jesús Gabriel y Galán <jgabrielygalan@gmail.com> - 2011-04-27 16:47 -0500
  Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-27 17:33 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-27 19:08 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-27 19:50 -0500
  Re: File position and buffers Robert Klemme <shortcutter@googlemail.com> - 2011-04-28 02:54 -0500
    Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 13:06 -0500
      Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 13:25 -0500
        Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 13:29 -0500
  Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 09:06 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 12:47 -0500
    Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 13:27 -0500
      Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 18:31 -0500
        Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 20:05 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 21:58 -0500
    Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 10:20 -0500
  Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-28 22:36 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-29 12:50 -0500
    Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 13:32 -0500
      Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-29 17:45 -0500
  Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-29 15:38 -0500
  Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 16:10 -0500

csiph-web