Re: File position and buffers

Path	csiph.com!x330-a1.tempe.blueboxinc.net!usenet.pasdenom.info!aioe.org!feeder.news-service.com!de-l.enfer-du-nord.net!feeder2.enfer-du-nord.net!talisker.lacave.net!lacave.net!not-for-mail
From	Cee Joe <cyril_jose@ymail.com>
Newsgroups	comp.lang.ruby
Subject	Re: File position and buffers
Date	Fri, 29 Apr 2011 16:10:46 -0500
Organization	Service de news de lacave.net
Lines	23
Message-ID	<090da92f89a453132178ba5faadfcc2c@ruby-forum.com> (permalink)
References	<10d8ae57765e21626a7c64873dcba807@ruby-forum.com>
NNTP-Posting-Host	bristol.highgroove.com
Content-Type	text/plain; charset=UTF-8
Content-Transfer-Encoding	7bit
X-Trace	talisker.lacave.net 1304111482 34289 65.111.164.187 (29 Apr 2011 21:11:22 GMT)
X-Complaints-To	abuse@lacave.net
NNTP-Posting-Date	Fri, 29 Apr 2011 21:11:22 +0000 (UTC)
In-Reply-To	<10d8ae57765e21626a7c64873dcba807@ruby-forum.com>
X-Received-From	This message has been automatically forwarded from the ruby-talk mailing list by a gateway at comp.lang.ruby. If it is SPAM, it did not originate at comp.lang.ruby. Please report the original sender, and not us. Thanks! For more details about this gateway, please visit: http://blog.grayproductions.net/categories/the_gateway
X-Mail-Count	382403
X-Ml-Name	ruby-talk
X-Rubymirror	Yes
X-Ruby-Talk	<090da92f89a453132178ba5faadfcc2c@ruby-forum.com>
Xref	x330-a1.tempe.blueboxinc.net comp.lang.ruby:3716

Show key headers only | View raw

Hi Jake,

I would still need the header intact, which should be away from the rest 
of the entry:

>gi|329295464|ref|NM_2005745.3Acc1| Def1 zgc:65895 (zgc:65895), mRNA
AGCTCGGGGGCTCTAGCGATTTAAGGAGCGATGCGATCGAGCTGACCGTCGCG

instead of:

">gi|329295464|ref|NM_2005745.3Acc1| Def1 zgc:65895 (zgc:65895),
mRNAAGCTCGGGGGCTCTAGCGATTTAAGGAGCGATGCGATCGAGCTGACCGTCGCG>"

Still need the header line so I can extract information from that and 
the lines after that in each entry. Your delete() will delete all the 
newlines, which would not be beneficial in this scenario. Thanks for the 
input, appreciate it.

-Cee

-- 
Posted via http://www.ruby-forum.com/.

Back to comp.lang.ruby | Previous | Next — Previous in thread | Find similar | Unroll thread

Thread

File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-27 15:02 -0500
  Re: File position and buffers Jesús Gabriel y Galán <jgabrielygalan@gmail.com> - 2011-04-27 16:47 -0500
  Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-27 17:33 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-27 19:08 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-27 19:50 -0500
  Re: File position and buffers Robert Klemme <shortcutter@googlemail.com> - 2011-04-28 02:54 -0500
    Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 13:06 -0500
      Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 13:25 -0500
        Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 13:29 -0500
  Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 09:06 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 12:47 -0500
    Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 13:27 -0500
      Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 18:31 -0500
        Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 20:05 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 21:58 -0500
    Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 10:20 -0500
  Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-28 22:36 -0500
  Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-29 12:50 -0500
    Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 13:32 -0500
      Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-29 17:45 -0500
  Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-29 15:38 -0500
  Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 16:10 -0500

csiph-web