Groups | Search | Server Info | Keyboard shortcuts | Login | Register [http] [https] [nntp] [nntps]

Groups > comp.os.linux.advocacy > #289267

Re: For Ezekilel ,multi-threaded version

Newsgroups comp.os.linux.advocacy
Followup-To comp.os.linux.advocacy
From GreyCloud <mist@cumulus.com>
Subject Re: For Ezekilel ,multi-threaded version
Date 2015-04-12 12:56 -0600
References <20150412103621.3c2c0560@maxa-pc> <mgdi9s$9sv$1@dont-email.me> <20150412172154.2924e5b1@maxa-pc>
Message-ID <ocudnUeJC4dZIrfInZ2dnUU7-XOdnZ2d@bresnan.com> (permalink)

Followups directed to: comp.os.linux.advocacy

Show all headers | View raw

Melzzzzz wrote:

> On Sun, 12 Apr 2015 06:45:09 -0400
> Chris Ahlstrom <OFeem1987@teleworm.us> wrote:
> 
>> Melzzzzz wrote this copyrighted missive and expects royalties:
>> 
>> > Look at this one, I wrote it yesterday  ;)
>> >
>> > alu db 'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG'
>> >     db 'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA'
>> >     db 'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT'
>> >     db 'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA'
>> >     db 'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG'
>> >     db 'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC'
>> >     db 'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA'
>> 
>> Looks like coding in assembler is in Melzzzzz's DNA :-D
>> 
> 
> Yeah ;)

Looks like you do this for a living in this field?

Where did you learn assembler?

Back to comp.os.linux.advocacy | Previous | Next — Previous in thread | Next in thread | Find similar | Unroll thread

Thread

For Ezekilel ,multi-threaded version Melzzzzz <mel@zzzzz.com> - 2015-04-12 10:36 +0200
  Re: For Ezekilel ,multi-threaded version Chris Ahlstrom <OFeem1987@teleworm.us> - 2015-04-12 06:45 -0400
    Re: For Ezekilel ,multi-threaded version Melzzzzz <mel@zzzzz.com> - 2015-04-12 17:21 +0200
      Re: For Ezekilel ,multi-threaded version GreyCloud <mist@cumulus.com> - 2015-04-12 12:56 -0600
        Re: For Ezekilel ,multi-threaded version Melzzzzz <mel@zzzzz.com> - 2015-04-12 21:08 +0200
          Re: For Ezekilel ,multi-threaded version GreyCloud <mist@cumulus.com> - 2015-04-12 14:44 -0600
            Re: For Ezekilel ,multi-threaded version Melzzzzz <mel@zzzzz.com> - 2015-04-12 22:47 +0200
              Re: For Ezekilel ,multi-threaded version Peter Köhlmann <peter-koehlmann@t-online.de> - 2015-04-12 23:42 +0200
                Re: For Ezekilel ,multi-threaded version Melzzzzz <mel@zzzzz.com> - 2015-04-13 05:25 +0200
                Re: For Ezekilel ,multi-threaded version Peter Köhlmann <peter-koehlmann@t-online.de> - 2015-04-13 09:37 +0200
                Re: For Ezekilel ,multi-threaded version Melzzzzz <mel@zzzzz.com> - 2015-04-13 11:51 +0200
                Re: For Ezekilel ,multi-threaded version -hh <recscuba_google@huntzinger.com> - 2015-04-13 08:30 -0700
                Re: For Ezekilel ,multi-threaded version Steve Carroll <fretwizzer@gmail.com> - 2015-04-13 09:11 -0700
                Re: For Ezekilel ,multi-threaded version Slimer <slvrslmr@lv.c> - 2015-04-13 08:55 -0400
    Re: For Ezekilel ,multi-threaded version taka0038@gmail.com - 2015-04-12 08:40 -0700
      Ezekiel, multi-threaded moron Chris Ahlstrom <OFeem1987@teleworm.us> - 2015-04-12 13:10 -0400
        Re: Ezekiel, multi-threaded moron GreyCloud <mist@cumulus.com> - 2015-04-12 12:55 -0600
          Re: Christopher John Ahlstrom - moronic cock wiping  pansy "Ezekiel" <zeke@nosuchemail.com> - 2015-04-13 11:06 -0400
  Re: For Ezekilel ,multi-threaded version DFS <nospam@dfs.com> - 2015-04-12 13:22 -0400
    Re: For Ezekilel ,multi-threaded version Melzzzzz <mel@zzzzz.com> - 2015-04-12 19:35 +0200
    Re: For Ezekilel ,multi-threaded version owl <owl@rooftop.invalid> - 2015-04-12 17:45 +0000
  Re: For Ezekilel ,multi-threaded version Melzzzzz <mel@zzzzz.com> - 2015-04-13 05:23 +0200

csiph-web