Groups | Search | Server Info | Keyboard shortcuts | Login | Register [http] [https] [nntp] [nntps]

Groups > comp.os.linux.advocacy > #289194

Re: For Ezekilel ,multi-threaded version

From Chris Ahlstrom <OFeem1987@teleworm.us>
Newsgroups comp.os.linux.advocacy
Subject Re: For Ezekilel ,multi-threaded version
Date 2015-04-12 06:45 -0400
Organization None
Message-ID <mgdi9s$9sv$1@dont-email.me> (permalink)
References <20150412103621.3c2c0560@maxa-pc>

Show all headers | View raw

Melzzzzz wrote this copyrighted missive and expects royalties:

> Look at this one, I wrote it yesterday  ;)
>
> alu db 'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG'
>     db 'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA'
>     db 'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT'
>     db 'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA'
>     db 'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG'
>     db 'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC'
>     db 'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA'

Looks like coding in assembler is in Melzzzzz's DNA :-D

-- 
	Penn's aunts made great apple pies at low prices.  No one else in
town could compete with the pie rates of Penn's aunts.

Back to comp.os.linux.advocacy | Previous | Next — Previous in thread | Next in thread | Find similar | Unroll thread

Thread

For Ezekilel ,multi-threaded version Melzzzzz <mel@zzzzz.com> - 2015-04-12 10:36 +0200
  Re: For Ezekilel ,multi-threaded version Chris Ahlstrom <OFeem1987@teleworm.us> - 2015-04-12 06:45 -0400
    Re: For Ezekilel ,multi-threaded version Melzzzzz <mel@zzzzz.com> - 2015-04-12 17:21 +0200
      Re: For Ezekilel ,multi-threaded version GreyCloud <mist@cumulus.com> - 2015-04-12 12:56 -0600
        Re: For Ezekilel ,multi-threaded version Melzzzzz <mel@zzzzz.com> - 2015-04-12 21:08 +0200
          Re: For Ezekilel ,multi-threaded version GreyCloud <mist@cumulus.com> - 2015-04-12 14:44 -0600
            Re: For Ezekilel ,multi-threaded version Melzzzzz <mel@zzzzz.com> - 2015-04-12 22:47 +0200
              Re: For Ezekilel ,multi-threaded version Peter Köhlmann <peter-koehlmann@t-online.de> - 2015-04-12 23:42 +0200
                Re: For Ezekilel ,multi-threaded version Melzzzzz <mel@zzzzz.com> - 2015-04-13 05:25 +0200
                Re: For Ezekilel ,multi-threaded version Peter Köhlmann <peter-koehlmann@t-online.de> - 2015-04-13 09:37 +0200
                Re: For Ezekilel ,multi-threaded version Melzzzzz <mel@zzzzz.com> - 2015-04-13 11:51 +0200
                Re: For Ezekilel ,multi-threaded version -hh <recscuba_google@huntzinger.com> - 2015-04-13 08:30 -0700
                Re: For Ezekilel ,multi-threaded version Steve Carroll <fretwizzer@gmail.com> - 2015-04-13 09:11 -0700
                Re: For Ezekilel ,multi-threaded version Slimer <slvrslmr@lv.c> - 2015-04-13 08:55 -0400
    Re: For Ezekilel ,multi-threaded version taka0038@gmail.com - 2015-04-12 08:40 -0700
      Ezekiel, multi-threaded moron Chris Ahlstrom <OFeem1987@teleworm.us> - 2015-04-12 13:10 -0400
        Re: Ezekiel, multi-threaded moron GreyCloud <mist@cumulus.com> - 2015-04-12 12:55 -0600
          Re: Christopher John Ahlstrom - moronic cock wiping  pansy "Ezekiel" <zeke@nosuchemail.com> - 2015-04-13 11:06 -0400
  Re: For Ezekilel ,multi-threaded version DFS <nospam@dfs.com> - 2015-04-12 13:22 -0400
    Re: For Ezekilel ,multi-threaded version Melzzzzz <mel@zzzzz.com> - 2015-04-12 19:35 +0200
    Re: For Ezekilel ,multi-threaded version owl <owl@rooftop.invalid> - 2015-04-12 17:45 +0000
  Re: For Ezekilel ,multi-threaded version Melzzzzz <mel@zzzzz.com> - 2015-04-13 05:23 +0200

csiph-web