Groups | Search | Server Info | Keyboard shortcuts | Login | Register [http] [https] [nntp] [nntps]


Groups > linux.debian.bugs.rc > #377869

Bug#1067374: blasr: FTBFS fixed by itself (but autopkgtest fails)

From Nilesh Patra <nilesh@riseup.net>
Newsgroups linux.debian.bugs.rc
Subject Bug#1067374: blasr: FTBFS fixed by itself (but autopkgtest fails)
Date 2024-12-08 10:00 +0100
Message-ID <JRliV-eEqG-1@gated-at.bofh.it> (permalink)
References (3 earlier) <JQZs5-eot2-3@gated-at.bofh.it> <JR0Hw-ep89-5@gated-at.bofh.it> <JR3m1-eqN4-3@gated-at.bofh.it> <Ikbw0-u9x-127@gated-at.bofh.it> <JR3m1-eqN4-3@gated-at.bofh.it>
Organization linux.* mail to news gateway

Show all headers | View raw



On 07/12/24 18:53, Nilesh Patra wrote:
> On 07/12/24 4:25 pm, Étienne Mollier wrote:
>> There does not seem to have been much changes.  Maybe the error
>> is somewhere else?  I hope I ran the test properly, it was a bit
>> intricate.
> 
> Your earlier reply to the bug report had this trace:
> 
> /usr/include/c++/14/bits/stl_vector.h:1130:
>          std::vector<_Tp, _Alloc>::reference
>          std::vector<_Tp, _Alloc>::operator[](size_type)
>          [
>              with _Tp = ChainedMatchPos;
>              _Alloc = std::allocator<ChainedMatchPos>;
>              reference = ChainedMatchPos&;
>              size_type = long unsigned int
>          ]: Assertion '__n < this->size()' failed.
>      /tmp/autopkgtest.WdOt0L/build.sPS/src/debian/tests/run-unit-
> 
> The Assertion failure "'__n < this->size()' failed." indicates that the index is going out of bounds in the vector. (upper bound)
> 
> Do you still see this trace? If so, maybe the versions are not tested correctly?ensuring blasr is built against patches pbseqlib?

I tried this on a debian:unstable docker container and it does seem to pass for me

On plain build of blasr:

root@306d2e75fdf4:~/blasr-5.3.5+dfsg# bash ./debian/tests/run-unit-test
[INFO] 2024-12-08T08:46:54 [blasr] started.
/usr/include/c++/14/bits/stl_vector.h:1130: std::vector<_Tp, _Alloc>::reference std::vector<_Tp, _Alloc>::operator[](size_type) [with _Tp = ChainedMatchPos; _Alloc = std::allocator<ChainedMatchPos>; reference = ChainedMatchPos&; size_type = long unsigned int]: Assertion '__n < this->size()' failed.
Aborted (core dumped)


With pbseqlib patched and installed on the container, and building blasr against it:

root@306d2e75fdf4:~/blasr-5.3.5+dfsg# bash ./debian/tests/run-unit-test
[INFO] 2024-12-08T08:48:39 [blasr] started.
[INFO] 2024-12-08T08:48:39 [blasr] ended.
[INFO] 2024-12-08T08:48:39 [blasr] started.
[INFO] 2024-12-08T08:48:39 [blasr] ended.
alignment.sam
@HD	VN:1.5	SO:UNKNOWN	pb:3.0.1
@SQ	SN:test/0/0_68	LN:59	M5:157f8fd9cd009034b02081c9fa7a1084
@RG	ID:e70794ea	PL:PACBIO	DS:READTYPE=SUBREAD;DeletionQV=dq;DeletionTag=dt;InsertionQV=iq;MergeQV=mq;SubstitutionQV=sq	PU:query.fasta	PM:SEQUEL
@PG	ID:1	PN:BLASR	VN:5.3.5-5.3.5	CL:blasr query.fasta ref.fa --sam --out alignment.sam
movie/0/0_51	0	test/0/0_68	1	254	50=1S	*	0	0	ATGTCAGTGACGATGACAGTAGACAGATAGAGAGGAGAGATAGACAGATAG	*	RG:Z:e70794ea	np:i:1	qe:i:51	qs:i:0	zm:i:0	AS:i:-250	NM:i:0
alignment.sam.check:
@HD	VN:1.5	SO:UNKNOWN	pb:3.0.1
@SQ	SN:test/0/0_68	LN:59	M5:157f8fd9cd009034b02081c9fa7a1084
@RG	ID:e70794ea	PL:PACBIO	DS:READTYPE=SUBREAD;DeletionQV=dq;DeletionTag=dt;InsertionQV=iq;MergeQV=mq;SubstitutionQV=sq	PU:query.fasta	PM:SEQUEL
@PG	ID:1	PN:BLASR	VN:VERSION	CL:blasr query.fasta ref.fa --sam --out alignment.sam
movie/0/0_51	0	test/0/0_68	1	254	50=1S	*	0	0	ATGTCAGTGACGATGACAGTAGACAGATAGAGAGGAGAGATAGACAGATAG	*	RG:Z:e70794ea	np:i:1	qe:i:51	qs:i:0	zm:i:0	AS:i:-250	NM:i:0
output: OK
alignment.sam.check: OK
Expected output and generated output are same: PASS Test

Back to linux.debian.bugs.rc | Previous | Next — Previous in thread | Find similar | Unroll thread


Thread

Bug#1067374: blasr: FTBFS fixed by itself (but autopkgtest fails) Étienne Mollier <emollier@debian.org> - 2024-11-20 22:00 +0100
  Processed: Re: Bug#1067374: blasr: FTBFS fixed by itself (but  autopkgtest fails) "Debian Bug Tracking System" <owner@bugs.debian.org> - 2024-11-20 22:00 +0100
  Bug#1067374: blasr: FTBFS fixed by itself (but autopkgtest fails) Nilesh Patra <nilesh@riseup.net> - 2024-12-07 10:40 +0100
    Bug#1067374: blasr: FTBFS fixed by itself (but autopkgtest fails) Étienne Mollier <emollier@debian.org> - 2024-12-07 12:00 +0100
      Bug#1067374: blasr: FTBFS fixed by itself (but autopkgtest fails) Nilesh Patra <nilesh@riseup.net> - 2024-12-07 14:50 +0100
        Bug#1067374: blasr: FTBFS fixed by itself (but autopkgtest fails) Nilesh Patra <nilesh@riseup.net> - 2024-12-08 10:00 +0100

csiph-web