Groups | Search | Server Info | Keyboard shortcuts | Login | Register [http] [https] [nntp] [nntps]

Groups > comp.lang.ruby > #3574 > unrolled thread

File position and buffers

Back to article view | Back to comp.lang.ruby

Contents

  File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-27 15:02 -0500
    Re: File position and buffers Jesús Gabriel y Galán <jgabrielygalan@gmail.com> - 2011-04-27 16:47 -0500
    Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-27 17:33 -0500
    Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-27 19:08 -0500
    Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-27 19:50 -0500
    Re: File position and buffers Robert Klemme <shortcutter@googlemail.com> - 2011-04-28 02:54 -0500
      Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 13:06 -0500
        Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 13:25 -0500
          Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 13:29 -0500
    Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 09:06 -0500
    Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 12:47 -0500
      Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 13:27 -0500
        Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 18:31 -0500
          Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-28 20:05 -0500
    Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-28 21:58 -0500
      Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 10:20 -0500
    Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-28 22:36 -0500
    Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-29 12:50 -0500
      Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 13:32 -0500
        Re: File position and buffers 7stud -- <bbxx789_05ss@yahoo.com> - 2011-04-29 17:45 -0500
    Re: File position and buffers jake kaiden <jakekaiden@yahoo.com> - 2011-04-29 15:38 -0500
    Re: File position and buffers Cee Joe <cyril_jose@ymail.com> - 2011-04-29 16:10 -0500

Page 2 of 2 — ← Prev page 1 [2]

#3712

hi Cee -

  hmm, i'm getting a bit confused as to what exactly you're trying to do 
- but if you want to load all this stuff into a buffer without the 
newlines, and regardless of how many newlines you have between each 
entry (assuming that an "entry" is something that starts with ">") - i 
don't see why this wouldn't work:

f = "0text.txt"
file  = File.open(f)
buffer = []
bufferindex = 0

file.each(sep = ">"){|line|
  buffer[bufferindex] = line
  bufferindex += 1
}

## here you would do something more interesting
buffer.collect{|line|
  line = line.delete("\n")
  p ">#{line}"
}


  which will return...
">>"
">gi|329295464|ref|NM_2005745.3Acc1| Def1 zgc:65895 (zgc:65895), 
mRNAAGCTCGGGGGCTCTAGCGATTTAAGGAGCGATGCGATCGAGCTGACCGTCGCG>"
">gi|456299107|ref|NM_2342343.3Acc2| Def2 zgc:65895 (zgc:65895), 
mRNAGTCGCTGGGTCGAAAAGTGGTGCTATATCGCGGCTCGCGTCGATGTCGCGATGCGTGCGCGCGAGAGCGCGCTATGATGAAAGGATGAGAGAG>"
">gi|3542945647|ref|NM_7453343.5Acc3| Def3 zgc:65895 (zgc:65895), 
mRNACGTGCGGGGABCCGTACGTGCCGTGGGGGTTTAATAGCGCGCCATCTGAGCAGTTAGTCGCTGACGCATGCACG"

  ...whether you have 0 or 100,000 newlines between each entry.  is this 
not what you're looking for?

 -j

-- 
Posted via http://www.ruby-forum.com/.

[toc] | [prev] | [next] | [standalone]

#3716

Hi Jake,

I would still need the header intact, which should be away from the rest 
of the entry:

>gi|329295464|ref|NM_2005745.3Acc1| Def1 zgc:65895 (zgc:65895), mRNA
AGCTCGGGGGCTCTAGCGATTTAAGGAGCGATGCGATCGAGCTGACCGTCGCG

instead of:

">gi|329295464|ref|NM_2005745.3Acc1| Def1 zgc:65895 (zgc:65895),
mRNAAGCTCGGGGGCTCTAGCGATTTAAGGAGCGATGCGATCGAGCTGACCGTCGCG>"

Still need the header line so I can extract information from that and 
the lines after that in each entry. Your delete() will delete all the 
newlines, which would not be beneficial in this scenario. Thanks for the 
input, appreciate it.

-Cee

-- 
Posted via http://www.ruby-forum.com/.

[toc] | [prev] | [standalone]

Page 2 of 2 — ← Prev page 1 [2]

Back to top | Article view | comp.lang.ruby

csiph-web