Groups | Search | Server Info | Keyboard shortcuts | Login | Register [http] [https] [nntp] [nntps]

Groups > comp.lang.python > #64353

regex multiple patterns in order

Show all headers | View raw

[Multipart message — attachments visible in raw view] - view raw

I am trying to find sub sequence patterns but constrained by the order in
which they occur
For example

>>> p = re.compile('(CAA)+?(TCT)+?(TA)+?')
>>> p.findall('CAACAACAATCTTCTTCTTCTTATATA')
[('CAA', 'TCT', 'TA')]

But I instead find only one instance of the CAA/TCT/TA in that order.
How can I get 3 matches of CAA, followed by  four matches of TCT followed
by 2 matches of TA ?
Well these patterns (CAA/TCT/TA) can occur any number of  times and atleast
once so I have to use + in the regex.

Please let me know.
Thanks!

Regards,
Krishna mohan

Back to comp.lang.python | Previous | Next | Find similar | Unroll thread

Thread

regex multiple patterns in order km <srikrishnamohan@gmail.com> - 2014-01-20 16:14 +0530

csiph-web