Path: csiph.com!v102.xanadu-bbs.net!xanadu-bbs.net!feeder.erje.net!eu.feeder.erje.net!news.stack.nl!newsfeed.xs4all.nl!newsfeed1a.news.xs4all.nl!xs4all!newsgate.cistron.nl!newsgate.news.xs4all.nl!post.news.xs4all.nl!not-for-mail Return-Path: X-Original-To: python-list@python.org Delivered-To: python-list@mail.python.org X-Spam-Status: OK 0.042 X-Spam-Evidence: '*H*': 0.92; '*S*': 0.00; 'patterns': 0.04; 'matches': 0.07; 'sub': 0.09; 'of\xa0': 0.16; 'followed': 0.16; 'trying': 0.19; 'skip:p 40': 0.19; '>>>': 0.22; 'example': 0.22; '>>>': 0.24; 'order.': 0.26; 'message- id:@mail.gmail.com': 0.30; 'know.': 0.32; 'thanks!': 0.32; 'but': 0.35; 'received:google.com': 0.35; 'sequence': 0.36; 'to:addr :python-list': 0.38; 'to:addr:python.org': 0.39; 'how': 0.40; 'times': 0.62; 'occur': 0.65; 'skip:r 30': 0.69; 'by\xa0': 0.84; 'krishna': 0.84 DKIM-Signature: v=1; a=rsa-sha256; c=relaxed/relaxed; d=gmail.com; s=20120113; h=mime-version:date:message-id:subject:from:to:content-type; bh=iVrMPlbWZklUxuyQ1vJKg4RJVUngt5nlViVOIVyt8Fk=; b=X3P8xVdPHMLAbS3XXx7hR+wGE0n6uR+LLBhRSFs2vtIBd8QZ14PtyDvDSUIpF3oJdJ kh5kMQ4g1k4fM7YC1VkF4+IBWWPe33xMVbzI86fsFNhrt41iPIprniVgDYvH5EeDyi7n cLzEWqGWroTz3hklz5WujNT8sPzp0pk/h3XAFv0A9hM8NU5k2dzBQz40j6ED1ePL6A5F o9K8ncR8tZLikUsN5JyjjM5ZoMjdgcOV2gdw8H1JstccYg8zH2FEH2St83g84ELWH/DB zEbHEP3I1NPaCv2OHvj2I18VPW60t9a6HLbdqlgS+OZr6CW7AA342HL49RMl0MZ/bPZE rnGg== MIME-Version: 1.0 X-Received: by 10.229.105.9 with SMTP id r9mr26631757qco.12.1390214658536; Mon, 20 Jan 2014 02:44:18 -0800 (PST) Date: Mon, 20 Jan 2014 16:14:18 +0530 Subject: regex multiple patterns in order From: km To: python-list@python.org Content-Type: multipart/alternative; boundary=001a113382b4e23b6104f064929b X-Mailman-Approved-At: Mon, 20 Jan 2014 11:53:39 +0100 X-BeenThere: python-list@python.org X-Mailman-Version: 2.1.15 Precedence: list List-Id: General discussion list for the Python programming language List-Unsubscribe: , List-Archive: List-Post: List-Help: List-Subscribe: , Newsgroups: comp.lang.python Message-ID: Lines: 43 NNTP-Posting-Host: 2001:888:2000:d::a6 X-Trace: 1390215221 news.xs4all.nl 2940 [2001:888:2000:d::a6]:54892 X-Complaints-To: abuse@xs4all.nl Xref: csiph.com comp.lang.python:64353 --001a113382b4e23b6104f064929b Content-Type: text/plain; charset=ISO-8859-1 I am trying to find sub sequence patterns but constrained by the order in which they occur For example >>> p = re.compile('(CAA)+?(TCT)+?(TA)+?') >>> p.findall('CAACAACAATCTTCTTCTTCTTATATA') [('CAA', 'TCT', 'TA')] But I instead find only one instance of the CAA/TCT/TA in that order. How can I get 3 matches of CAA, followed by four matches of TCT followed by 2 matches of TA ? Well these patterns (CAA/TCT/TA) can occur any number of times and atleast once so I have to use + in the regex. Please let me know. Thanks! Regards, Krishna mohan --001a113382b4e23b6104f064929b Content-Type: text/html; charset=ISO-8859-1 Content-Transfer-Encoding: quoted-printable

I am trying to find sub sequ= ence patterns but constrained by the order in which they occur

For= example

>>> p =3D re.compile('(CAA)+?(TCT)+?(TA)+?= 9;)
>>> p.findall('CAACAACAATCTTCTTCTTCTTATATA')
[('CAA= ', 'TCT', 'TA')]

But I instead find only o= ne instance of the CAA/TCT/TA in that order.

How can I get 3 match= es of CAA, followed by=A0 four matches of TCT followed by 2 matches of TA ?=

Well these patterns (CAA/TCT/TA) can occur any number of=A0 times and= atleast once so I have to use + in the regex.

Please let= me know.

Thanks!

Regards,

Krishna moha= n

--001a113382b4e23b6104f064929b--