Groups | Search | Server Info | Keyboard shortcuts | Login | Register [http] [https] [nntp] [nntps]


Groups > comp.lang.python > #64361

Re: regex multiple patterns in order

Path csiph.com!v102.xanadu-bbs.net!xanadu-bbs.net!nntp.club.cc.cmu.edu!micro-heart-of-gold.mit.edu!bloom-beacon.mit.edu!panix!roy
From Roy Smith <roy@panix.com>
Newsgroups comp.lang.python
Subject Re: regex multiple patterns in order
Date Mon, 20 Jan 2014 09:52:59 -0500
Organization PANIX Public Access Internet and UNIX, NYC
Lines 64
Message-ID <roy-C6EC2C.09525920012014@news.panix.com> (permalink)
References <CAPV1RAAiD3qWqrAJYc4yb80CaHG4A9N4jz4aY_CsyJr_nAUx9Q@mail.gmail.com> <mailman.5748.1390216721.18130.python-list@python.org>
NNTP-Posting-Host localhost
X-Trace reader1.panix.com 1390229580 28062 127.0.0.1 (20 Jan 2014 14:53:00 GMT)
X-Complaints-To abuse@panix.com
NNTP-Posting-Date Mon, 20 Jan 2014 14:53:00 +0000 (UTC)
User-Agent MT-NewsWatcher/3.5.3b3 (Intel Mac OS X)
Xref csiph.com comp.lang.python:64361

Show key headers only | View raw


In article <mailman.5748.1390216721.18130.python-list@python.org>,
 Ben Finney <ben+python@benfinney.id.au> wrote:

> With a little experimenting I get:
> 
>     >>> p = re.compile('((?:CAA)+)?((?:TCT)+)?((?:TA)+)?')
>     >>> p.findall('CAACAACAATCTTCTTCTTCTTATATA')
>     [('CAACAACAA', 'TCTTCTTCTTCT', 'TATATA'), ('', '', '')]

Perhaps a matter of style, but I would have left off the ?: markers and 
done this:

p = re.compile('((CAA)+)((TCT)+)((TA)+)')
m = p.match('CAACAACAATCTTCTTCTTCTTATATA')
print m.groups()

$ python r.py
('CAACAACAA', 'CAA', 'TCTTCTTCTTCT', 'TCT', 'TATATA', 'TA')

The ?: says, "match this group, but don't save it".  The advantage of 
that is you don't get unwanted groups in your match object.  The 
disadvantage is they make the pattern more difficult to read.  My 
personal opinion is I'd rather make the pattern easier to read and just 
ignore the extra matches in the output (in this case, I want groups 0, 
2, and 4).

I also left off the outer ?s, because I think this better represents the 
intent.  The pattern '((CAA)+)?((TCT)+)?((TA)+)?' matches, for example, 
an empty string; I suspect that's not what was intended.

> Be aware that regex is not the solution to all parsing problems; for
> many parsing problems it is an attractive but inappropriate tool. You
> may need to construct a more specific parser for your needs. Even if
> it's possible with regex, the resulting pattern may be so complex that
> it's better to write it out more explicitly.

Oh, posh.

You are correct; regex is not the solution to all parsing problems, but 
it is a powerful tool which people should be encouraged to learn.  For 
some problems, it is indeed the correct tool, and this seems like one of 
them.  Discouraging people from learning about regexes is an educational 
anti-pattern which I see distressingly often on this newsgroup.

Several lives ago, I worked in a molecular biology lab writing programs 
to analyze DNA sequences.  Here's a common problem: "Find all the places 
where GACGTC or TTCGAA (or any of a similar set of 100 or so short 
patterns appear".  I can't think of an easier way to represent that in 
code than a regex.

Sure, it'll be a huge regex, which may take a long time to compile, but 
one of the nice things about these sorts of problems) is that the 
patterns you are looking for tend not to change very often.  For 
example, the problem I mention in the preceding paragraph is finding 
restriction sites, i.e. the locations where restriction enzymes will cut 
a strand of DNA.  There's a finite set of commercially available 
restriction enzymes, and that list doesn't change from month to month 
(at this point, maybe even from year to year).

For more details, see 
http://bioinformatics.oxfordjournals.org/content/4/4/459.abstract

Executive summary: I wrote my own regex compiler which was optimized for 
the types of patterns this problem required.

Back to comp.lang.python | Previous | NextPrevious in thread | Next in thread | Find similar | Unroll thread


Thread

Re: regex multiple patterns in order Ben Finney <ben+python@benfinney.id.au> - 2014-01-20 22:18 +1100
  Re: regex multiple patterns in order Roy Smith <roy@panix.com> - 2014-01-20 09:52 -0500
    Re: regex multiple patterns in order Neil Cerutti <neilc@norwich.edu> - 2014-01-20 16:04 +0000
    Re: regex multiple patterns in order Mark Lawrence <breamoreboy@yahoo.co.uk> - 2014-01-20 16:16 +0000
    Re: regex multiple patterns in order Devin Jeanpierre <jeanpierreda@gmail.com> - 2014-01-20 08:40 -0800
      Re: regex multiple patterns in order Rustom Mody <rustompmody@gmail.com> - 2014-01-20 09:06 -0800
        Re: regex multiple patterns in order Mark Lawrence <breamoreboy@yahoo.co.uk> - 2014-01-20 17:30 +0000
    Re: regex multiple patterns in order Neil Cerutti <neilc@norwich.edu> - 2014-01-20 17:09 +0000
    Re: regex multiple patterns in order Mark Lawrence <breamoreboy@yahoo.co.uk> - 2014-01-20 17:33 +0000

csiph-web