Groups | Search | Server Info | Keyboard shortcuts | Login | Register [http] [https] [nntp] [nntps]
Groups > comp.lang.python > #64357
| Path | csiph.com!newsfeed.hal-mli.net!feeder3.hal-mli.net!newsfeed.hal-mli.net!feeder1.hal-mli.net!newsfeed.xs4all.nl!newsfeed1.news.xs4all.nl!xs4all!newsgate.cistron.nl!newsgate.news.xs4all.nl!post.news.xs4all.nl!not-for-mail |
|---|---|
| Return-Path | <python-python-list@m.gmane.org> |
| X-Original-To | python-list@python.org |
| Delivered-To | python-list@mail.python.org |
| X-Spam-Status | OK 0.000 |
| X-Spam-Evidence | '*H*': 1.00; '*S*': 0.00; 'operator': 0.03; 'patterns': 0.04; 'resulting': 0.04; "'',": 0.07; 'matches': 0.07; 'parser': 0.07; 'parsing': 0.09; 'patterns,': 0.09; 'received:80.91': 0.09; 'received:80.91.229': 0.09; 'received:gmane.org': 0.09; 'received:list': 0.09; 'sub': 0.09; "('',": 0.16; 'finney': 0.16; 'punish': 0.16; 'received:80.91.229.3': 0.16; 'received:plane.gmane.org': 0.16; 'regex,': 0.16; 'repetition': 0.16; 'repetitions': 0.16; 'tool.': 0.16; 'followed': 0.16; 'trying': 0.19; 'skip:p 40': 0.19; '(the': 0.22; '>>>': 0.22; 'example': 0.22; '(in': 0.22; 'header:User- Agent:1': 0.23; 'specify': 0.24; 'order.': 0.26; 'header:X -Complaints-To:1': 0.27; 'testing': 0.29; 'returned': 0.30; "skip:' 10": 0.31; 'grouping': 0.31; 'writes:': 0.31; 'case,': 0.35; 'but': 0.35; 'there': 0.35; 'received:com.au': 0.36; 'sequence': 0.36; 'possible': 0.36; 'problems': 0.38; 'ben': 0.38; 'skip:[ 10': 0.38; 'to:addr:python-list': 0.38; 'little': 0.38; 'to:addr:python.org': 0.39; 'received:org': 0.40; 'how': 0.40; 'even': 0.60; 'skip:u 10': 0.60; 'authority': 0.60; 'times': 0.62; "you'll": 0.62; 'such': 0.63; 'group,': 0.63; 'more': 0.64; 'occur': 0.65; 'skip:r 40': 0.68; 'skip:r 30': 0.69; 'attractive': 0.81; 'received:125': 0.84 |
| X-Injected-Via-Gmane | http://gmane.org/ |
| To | python-list@python.org |
| From | Ben Finney <ben+python@benfinney.id.au> |
| Subject | Re: regex multiple patterns in order |
| Date | Mon, 20 Jan 2014 22:18:29 +1100 |
| References | <CAPV1RAAiD3qWqrAJYc4yb80CaHG4A9N4jz4aY_CsyJr_nAUx9Q@mail.gmail.com> |
| Mime-Version | 1.0 |
| Content-Type | text/plain; charset=utf-8 |
| Content-Transfer-Encoding | 8bit |
| X-Gmane-NNTP-Posting-Host | vmx15867.hosting24.com.au |
| X-Public-Key-ID | 0xBD41714B |
| X-Public-Key-Fingerprint | 9CFE 12B0 791A 4267 887F 520C B7AC 2E51 BD41 714B |
| X-Public-Key-URL | http://www.benfinney.id.au/contact/bfinney-gpg.asc |
| X-Post-From | Ben Finney <bignose+hates-spam@benfinney.id.au> |
| User-Agent | Gnus/5.13 (Gnus v5.13) Emacs/23.2 (gnu/linux) |
| Cancel-Lock | sha1:1cFM6IuKhItG+xRyujtKkt69oV0= |
| X-BeenThere | python-list@python.org |
| X-Mailman-Version | 2.1.15 |
| Precedence | list |
| List-Id | General discussion list for the Python programming language <python-list.python.org> |
| List-Unsubscribe | <https://mail.python.org/mailman/options/python-list>, <mailto:python-list-request@python.org?subject=unsubscribe> |
| List-Archive | <http://mail.python.org/pipermail/python-list/> |
| List-Post | <mailto:python-list@python.org> |
| List-Help | <mailto:python-list-request@python.org?subject=help> |
| List-Subscribe | <https://mail.python.org/mailman/listinfo/python-list>, <mailto:python-list-request@python.org?subject=subscribe> |
| Newsgroups | comp.lang.python |
| Message-ID | <mailman.5748.1390216721.18130.python-list@python.org> (permalink) |
| Lines | 48 |
| NNTP-Posting-Host | 2001:888:2000:d::a6 |
| X-Trace | 1390216721 news.xs4all.nl 2924 [2001:888:2000:d::a6]:48215 |
| X-Complaints-To | abuse@xs4all.nl |
| Xref | csiph.com comp.lang.python:64357 |
Show key headers only | View raw
km <srikrishnamohan@gmail.com> writes:
> I am trying to find sub sequence patterns but constrained by the order
> in which they occur
There are also specific resources for understanding and testing regex
patterns, such as <URL:http://www.pythonregex.com/>.
> For example
>
> >>> p = re.compile('(CAA)+?(TCT)+?(TA)+?')
> >>> p.findall('CAACAACAATCTTCTTCTTCTTATATA')
> [('CAA', 'TCT', 'TA')]
>
> But I instead find only one instance of the CAA/TCT/TA in that order.
Yes, because the grouping operator (the parens ‘()’) in each case
contains exactly “CAA”, “TCT”, “TA”. If you want the repetitions to be
part of the group, you need the repetition operator (in your case, ‘+’)
to be part of the group.
> How can I get 3 matches of CAA, followed by four matches of TCT followed
> by 2 matches of TA ?
With a little experimenting I get:
>>> p = re.compile('((?:CAA)+)?((?:TCT)+)?((?:TA)+)?')
>>> p.findall('CAACAACAATCTTCTTCTTCTTATATA')
[('CAACAACAA', 'TCTTCTTCTTCT', 'TATATA'), ('', '', '')]
Remember that you'll get no more than one group returned for each group
you specify in the pattern.
> Well these patterns (CAA/TCT/TA) can occur any number of times and
> atleast once so I have to use + in the regex.
Be aware that regex is not the solution to all parsing problems; for
many parsing problems it is an attractive but inappropriate tool. You
may need to construct a more specific parser for your needs. Even if
it's possible with regex, the resulting pattern may be so complex that
it's better to write it out more explicitly.
--
\ “To punish me for my contempt of authority, Fate has made me an |
`\ authority myself.” —Albert Einstein, 1930-09-18 |
_o__) |
Ben Finney
Back to comp.lang.python | Previous | Next — Next in thread | Find similar | Unroll thread
Re: regex multiple patterns in order Ben Finney <ben+python@benfinney.id.au> - 2014-01-20 22:18 +1100
Re: regex multiple patterns in order Roy Smith <roy@panix.com> - 2014-01-20 09:52 -0500
Re: regex multiple patterns in order Neil Cerutti <neilc@norwich.edu> - 2014-01-20 16:04 +0000
Re: regex multiple patterns in order Mark Lawrence <breamoreboy@yahoo.co.uk> - 2014-01-20 16:16 +0000
Re: regex multiple patterns in order Devin Jeanpierre <jeanpierreda@gmail.com> - 2014-01-20 08:40 -0800
Re: regex multiple patterns in order Rustom Mody <rustompmody@gmail.com> - 2014-01-20 09:06 -0800
Re: regex multiple patterns in order Mark Lawrence <breamoreboy@yahoo.co.uk> - 2014-01-20 17:30 +0000
Re: regex multiple patterns in order Neil Cerutti <neilc@norwich.edu> - 2014-01-20 17:09 +0000
Re: regex multiple patterns in order Mark Lawrence <breamoreboy@yahoo.co.uk> - 2014-01-20 17:33 +0000
csiph-web